View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0618_low_19 (Length: 293)
Name: NF0618_low_19
Description: NF0618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0618_low_19 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 293
Target Start/End: Complemental strand, 32822182 - 32821902
Alignment:
| Q |
1 |
tggtagtaatgttatggaagagtatgattctgttagtgctggtgatgctggtgcttattctaatttggatgagttgtatgtgaataatcctcgagctatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32822182 |
tggtagtaatgttatggaagagtatgattctgttagtgctggtgatgctggggcttattctaatttggatgagttgtatgtgaataatcctcgagctatt |
32822083 |
T |
|
| Q |
101 |
ttaccttgctttgttgtaatctacagaggcttttgataatgtgtattgtttggttttttgttggattaggggacgaaatttctttgcaatgtcacttgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32822082 |
ttaccttgctttgttgtaatctacagaggcttttgataatgtgtat------------tgttggattaggggacgaaatttctttgcaatgtcacttgat |
32821995 |
T |
|
| Q |
201 |
ggtgtttttagttcttttcttaattaatagtgtcctctagctaaatttagtctagttcagtggtgttttttaggggaagtagtagaattgcat |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32821994 |
ggtgtttttagttcttttcttaattaatagtgtcctctagctaaatttagtttagttcagtggtgttttttaggggaagtagtagaattgcat |
32821902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2782 times since January 2019
Visitors: 3829