View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0618_low_20 (Length: 291)
Name: NF0618_low_20
Description: NF0618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0618_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 36 - 230
Target Start/End: Original strand, 38287617 - 38287812
Alignment:
Q |
36 |
gaatcgaattcggattctttcgaacgattcgtctttgctgaaattcattaaccacttgagttctattgcttgattaggaatgcaaaatttgttactggaa |
135 |
Q |
|
|
||||||||||||||||||| | ||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
38287617 |
gaatcgaattcggattcttccaaacgattcgtcattgctgaaactcattaaccacttgagttctattgcttgattaggaatgcaaaatttgttactagaa |
38287716 |
T |
 |
Q |
136 |
aaaacgacttacatattaacttggacatgtcattnnnnnnntgttaatttgtacaac-annnnnnnnaattgaataaacaacaatttattagttca |
230 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
T |
38287717 |
aaaacgacttacatattaacttggacatgtcattaaaaaaatgttaatttgtacaacaattttttttaattgaataaacaacaatttattagttca |
38287812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 49 - 95
Target Start/End: Complemental strand, 39844041 - 39843995
Alignment:
Q |
49 |
attctttcgaacgattcgtctttgctgaaattcattaaccacttgag |
95 |
Q |
|
|
||||||||||| |||||||||||| |||| |||||| |||||||||| |
|
|
T |
39844041 |
attctttcgaatgattcgtctttggtgaagttcatttaccacttgag |
39843995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 59 - 107
Target Start/End: Original strand, 13043501 - 13043549
Alignment:
Q |
59 |
acgattcgtctttgctgaaattcattaaccacttgagttctattgcttg |
107 |
Q |
|
|
|||||||||| ||| ||||| |||||||||||||||| || |||||||| |
|
|
T |
13043501 |
acgattcgtccttgatgaaactcattaaccacttgagctcaattgcttg |
13043549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 37 - 94
Target Start/End: Complemental strand, 34548585 - 34548528
Alignment:
Q |
37 |
aatcgaattcggattctttcgaacgattcgtctttgctgaaattcattaaccacttga |
94 |
Q |
|
|
|||||||||||| || || ||||||| ||||||||| |||| |||||||| ||||||| |
|
|
T |
34548585 |
aatcgaattcgggttattccgaacgactcgtctttgatgaagttcattaatcacttga |
34548528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 95
Target Start/End: Complemental strand, 24363853 - 24363805
Alignment:
Q |
47 |
ggattctttcgaacgattcgtctttgctgaaattcattaaccacttgag |
95 |
Q |
|
|
|||||||| | ||||||||||| ||| ||||||| |||||||||||||| |
|
|
T |
24363853 |
ggattcttccaaacgattcgtccttggtgaaattaattaaccacttgag |
24363805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University