View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0618_low_27 (Length: 243)
Name: NF0618_low_27
Description: NF0618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0618_low_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 17166239 - 17166089
Alignment:
| Q |
1 |
tttcgagaacctatctatttttaatgtaggatttgagttttcctcaacatcctattttaaatatttcagatgaaatgacgtaaatctctttcaacttaaa |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17166239 |
tttcgagaacctatttatttttaatgtaggatttgagttttcctcaacaacctattttaaatatttcagatgaaatgacgtaaatctctttcaatttaaa |
17166140 |
T |
 |
| Q |
101 |
tagaagattttagagtattaacatttaaatttgtcattctacatacacttt |
151 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17166139 |
taggagattttagagtattaacatttaaatttatcattctacatacacttt |
17166089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 182 - 240
Target Start/End: Complemental strand, 17166088 - 17166030
Alignment:
| Q |
182 |
accttatattatgatttcattttcttacaaatttacatctttttggcttagggtctctg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17166088 |
accttatattatgatttcattttcttacaaatttacatctttttggcttagggtctctg |
17166030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University