View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0618_low_29 (Length: 236)
Name: NF0618_low_29
Description: NF0618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0618_low_29 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 48415155 - 48415393
Alignment:
| Q |
1 |
ctcatttcttccttcagtctcttcttttgcttcttcttcctagcccttctcctcgaatcatgttcctccgcgaacacttgattctgaccaagtttgtaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48415155 |
ctcatttcttccttcagtctcttcttttgcttcttcttcctagcccttctcctcgaatcatgttcctccacgaacacttgattctgaccaagtttgtaca |
48415254 |
T |
 |
| Q |
101 |
cagcttcaagctcacca---aagttgttgtcggaaaccaaacatctctcgttgttttccttttcatgttgttgtttttctgttgcatcacatggcaccgt |
197 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48415255 |
cagcttcaagctcaccagcaaagttgttgtcggaaaccaaacatctctcgttgttttccttttcatgttgttgtttttctgttgcatcacatagcaccgt |
48415354 |
T |
 |
| Q |
198 |
gttgttgaatgctttcctgaaaatgccaacacaaacatc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48415355 |
gttgttgaatgctttcctgaaaatgccaacacaaacatc |
48415393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University