View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0619_high_13 (Length: 393)
Name: NF0619_high_13
Description: NF0619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0619_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 2e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 86 - 240
Target Start/End: Complemental strand, 48193927 - 48193773
Alignment:
Q |
86 |
cctagctgttgccgacatgaatgcttcgctattctcgaaatcacaggtagatacaaataaataactacaggctgcgctcacttcannnnnnnnnnnnngg |
185 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
48193927 |
cctagcagttgccgacatgaatgcttcgctattctcgaaatcacaggtagatacaaataaataactacaggctgcgctcacttcatttttatttttttgg |
48193828 |
T |
 |
Q |
186 |
tgaattggctggccacttcattttgaattgaatccaaaagtataccataaaaagt |
240 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48193827 |
tgaattggctggccacttcattttgaattgaatccaaaagtataccataaaaagt |
48193773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1140 times since January 2019
Visitors: 3840