View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0619_high_33 (Length: 262)
Name: NF0619_high_33
Description: NF0619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0619_high_33 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 30 - 252
Target Start/End: Complemental strand, 22505757 - 22505535
Alignment:
| Q |
30 |
tcatggagtgacgtttggaaacaaaaataggcattagttttcacttattatttagcatcttccgtttatacttgacatatttatatactgaattttgttg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22505757 |
tcatggagtgacgtttggaaacaaaaataggcattagttttcacttattatttagcatcttccgtttatacttgacatatttatatactgaattttgttg |
22505658 |
T |
|
| Q |
130 |
catttatagtatatactttcgaaatctaatggttctactacatgttcaagatatcgtttgtcatttaatatatttacgatttcggttaaagaattttagt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22505657 |
catttatagtatatactttcgaaatctaatggttctactacatgttcaagatatcgtttgtcatttaatatatttacgatttcggttaaagaattttagt |
22505558 |
T |
|
| Q |
230 |
actcttttccttatttcttttca |
252 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
22505557 |
actcttttccttatttcttttca |
22505535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 173 times since January 2019
Visitors: 3831