View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0619_high_38 (Length: 251)
Name: NF0619_high_38
Description: NF0619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0619_high_38 |
 |  |
|
| [»] scaffold0291 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0291 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: scaffold0291
Description:
Target: scaffold0291; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 13019 - 13252
Alignment:
| Q |
13 |
tgaagcaaacaagctcgatatcacaccaccaagaacatggatctacatcttgacacccggatttggatttttgggtggtaaagggcagaggtggtggtgg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13019 |
tgaagcaaacaagctcgatatcacaccaccaagaacatggatctacatcttgacaactggatttggatttttgggtggtaaagggcggaggtggtggtgg |
13118 |
T |
 |
| Q |
113 |
tgatgggttcggaaagcttccttagtgagaatggagagaaacgtaagttcaaaaatgagggaatctcgatgtttttgaatttctaattataacaaacctt |
212 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13119 |
---tgggttgggaaagcttccttagttagaatggagagaaacgtaagttcaaaaatgagggaa--tcgatgtttttgaatttctaattataacaaacctg |
13213 |
T |
 |
| Q |
213 |
tcaaatcatacctaacaaaccatgtttaactttttcaat |
251 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13214 |
ttaaatcatacctaacaaaccatgtttaactttttcaat |
13252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University