View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0619_high_41 (Length: 250)
Name: NF0619_high_41
Description: NF0619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0619_high_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 11827516 - 11827765
Alignment:
Q |
1 |
aaagcaaaaccagtgtgataggcatttttattttgaaagaagtgtgatattttagacagtttgtatgtgggacaaagcaggaccggcccaaggcataggt |
100 |
Q |
|
|
|||| |||| || ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
T |
11827516 |
aaaggaaaatcaatgtgatatgcatttttattttgaaagaagtgtgatattttagacagtttgtatgtgggacaaagcagggccggaccaaggcataggt |
11827615 |
T |
 |
Q |
101 |
cgagggtgcggtgactttggatccattcccgtagggacccatacnnnnnnnnnccgggg---------gtgtatatatcaacactttgtttaaagagagt |
191 |
Q |
|
|
|| |||||||||||||||||||||||||||| ||||||||||| ||| |||| ||||||||||||||||||||||||||| |
|
|
T |
11827616 |
cgggggtgcggtgactttggatccattcccgcagggacccatatttttttttttttgggaggtggcgggtgtttatatcaacactttgtttaaagagagt |
11827715 |
T |
 |
Q |
192 |
ctatatagaaaaaattgcaaagaaggcccaaccctttatcgaactgcatc |
241 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||| ||| |||| |
|
|
T |
11827716 |
ctatatagaaaaaattgcaatgaaggcccaaccctttatcggacttcatc |
11827765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University