View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0619_low_28 (Length: 318)

Name: NF0619_low_28
Description: NF0619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0619_low_28
NF0619_low_28
[»] chr8 (1 HSPs)
chr8 (7-58)||(27003832-27003883)
[»] chr4 (1 HSPs)
chr4 (7-58)||(35537360-35537411)
[»] chr1 (1 HSPs)
chr1 (14-58)||(45860071-45860115)


Alignment Details
Target: chr8 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 7 - 58
Target Start/End: Complemental strand, 27003883 - 27003832
Alignment:
7 caactaaggagatgcataaatatctatgattcgcatataatctatgcaacag 58  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
27003883 caactaaggagatgcataaatatctatgattcgcatataatctatgcaacag 27003832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 7 - 58
Target Start/End: Original strand, 35537360 - 35537411
Alignment:
7 caactaaggagatgcataaatatctatgattcgcatataatctatgcaacag 58  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
35537360 caactaaggagatgcataaatatctatgattcgcatataatctatgcaacag 35537411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 14 - 58
Target Start/End: Complemental strand, 45860115 - 45860071
Alignment:
14 ggagatgcataaatatctatgattcgcatataatctatgcaacag 58  Q
    |||||||||||||||| |||||||| |||||||||||||||||||    
45860115 ggagatgcataaatatatatgattctcatataatctatgcaacag 45860071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 718 times since January 2019
Visitors: 3837