View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0619_low_34 (Length: 306)
Name: NF0619_low_34
Description: NF0619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0619_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 92 - 231
Target Start/End: Complemental strand, 41668224 - 41668085
Alignment:
| Q |
92 |
ggcacaatgttgggcaagatttgggttgaaggttactactcataacagaaaagtcgtagtagttgaacaattcatgtagccgtgtgtatcataaatggaa |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41668224 |
ggcacaatgttgggcaagatttgggttgaaggttactactcataacagaaaagtcgtagtagttgaacaattcatgtagccgtgtgtatcataaatggaa |
41668125 |
T |
 |
| Q |
192 |
aaaatgtttttttctgtgatcctggaatcaaataatttcg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41668124 |
aaaatgtttttttctgtgatcctggaatcaaataatttcg |
41668085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University