View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0619_low_4 (Length: 515)
Name: NF0619_low_4
Description: NF0619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0619_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 94 - 304
Target Start/End: Original strand, 44798252 - 44798462
Alignment:
Q |
94 |
acactgactttatttcagtttaacccctcaatggtcctatgtgaagaatcataactagaaatgtaatgttttgtttgaatttagaagacacaacaattca |
193 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44798252 |
acactgactttatttcagtttaacccctcaatggtcctatgtgaagaatcctaactaaaaatgtaatgttttgtttgaatttagaagacacaacaattca |
44798351 |
T |
 |
Q |
194 |
agattaggccaagaaacagattgagtatgtgtatcactctctctccttcatctttaccatgaaaacaaattcttgaaaacttcatcactcttaattctac |
293 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
44798352 |
agattagaacaagaaacagattgagtatgtgtatcactctctctccttcatctttaccatgaaaacaaattcttgaaaacttcaccactcttaattctac |
44798451 |
T |
 |
Q |
294 |
acaatgctcag |
304 |
Q |
|
|
||||||||||| |
|
|
T |
44798452 |
acaatgctcag |
44798462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 375 - 448
Target Start/End: Original strand, 44798533 - 44798606
Alignment:
Q |
375 |
caaaacatcacactctttggtgatgcttcctacacagacactgccattactctcacaaaacaacaacactcttg |
448 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
T |
44798533 |
caaaacatcacactctttggtgatgcttcctacacagacacttccattactctcacaaaacaacaacacacttg |
44798606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University