View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0619_low_40 (Length: 284)
Name: NF0619_low_40
Description: NF0619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0619_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 42 - 247
Target Start/End: Complemental strand, 53555916 - 53555711
Alignment:
Q |
42 |
tgtcagggcaatctcttccaacaatcgtttgtctgctgtcaacgtttatcttgaatcgcaaagattctgttccgtttgattatgagtgaattgattcatg |
141 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
53555916 |
tgtcagggcaatctcttccaacaatcgtttgtctgctgtcaacgtttttcttgaatcgcaaaggttctgttccgtttgattatgagtgaattgattcatg |
53555817 |
T |
 |
Q |
142 |
gttaaaatttgagttgaaaataaatcgggttattctaccctttttgtgagtatccttttttgatagaaatgtggatattgggtttgcaggtatgttcatt |
241 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53555816 |
gttaaaatttgagttgaaaataaatcgggttattctaccctttttgtgagtatctttttttgatagaaatgtggatattgggtttgcaggtatgttcatt |
53555717 |
T |
 |
Q |
242 |
tcactc |
247 |
Q |
|
|
|||||| |
|
|
T |
53555716 |
tcactc |
53555711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 201 - 246
Target Start/End: Complemental strand, 23008338 - 23008293
Alignment:
Q |
201 |
ttgatagaaatgtggatattgggtttgcaggtatgttcatttcact |
246 |
Q |
|
|
||||| |||||||||| ||||||||||||||||||| |||||||| |
|
|
T |
23008338 |
ttgatggaaatgtggactttgggtttgcaggtatgtttatttcact |
23008293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University