View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0619_low_41 (Length: 279)
Name: NF0619_low_41
Description: NF0619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0619_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 29 - 125
Target Start/End: Complemental strand, 51391680 - 51391584
Alignment:
Q |
29 |
actactgttggcattagacagaacaaactcatacattcatgatcaagtggttacattcgctgttctatttaactaatcatcatgaacagtaccgccg |
125 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51391680 |
actactgttggcattagacagaacaaactcatacattcatgatcaagtggttacatttgctgttctatttaactaatcatcatgaacagtaccgccg |
51391584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 186 - 267
Target Start/End: Complemental strand, 51391336 - 51391255
Alignment:
Q |
186 |
agacacgtgagtgagatgaaacccaaaatccttcttcatcgtcatacccttcttctccaaacccagaacccagcaacaccta |
267 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
51391336 |
agacacgtgagtgagatgaaacccaaaatccttcttcatcatcataccctttttctccaaacccagaacccagcaacaccta |
51391255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University