View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0619_low_42 (Length: 276)
Name: NF0619_low_42
Description: NF0619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0619_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 270
Target Start/End: Complemental strand, 41668000 - 41667731
Alignment:
| Q |
1 |
gcttcaacgtaaaatccctaccaaaaagaaaaacgtatagtagtnnnnnnnnttgtgttaaaacattgtactgtaacatggtatgacattattatttgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41668000 |
gcttcaacgtaaaatccctaccaaaaagaaaaacgtatagtagtaaaaaaaattgtgttaaaacattgtactgtaacatggtatgacattattatttgag |
41667901 |
T |
|
| Q |
101 |
cgatgcagtttctctttaagaaatcattaatttttatcgcaatatgcagcaaaccatataaacttaattaagagatcaatgcaccctatgatgggtgctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41667900 |
cgatgcagtttctctttaagaaatcattaatttttatcgcaatatgcagcaaaccatataaacttaattaagagatcaatgcaccctatgatgggtgctc |
41667801 |
T |
|
| Q |
201 |
tagaaatagaacatggacaaagaaaacaattaggaaaaacctattttggcaacttcctcgttcatctcac |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
41667800 |
tagaaatagaacatggacaaagaaaacaattaggaaaaacctattttggcaacttcttcgttcaactcac |
41667731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 939 times since January 2019
Visitors: 3837