View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0619_low_44 (Length: 272)
Name: NF0619_low_44
Description: NF0619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0619_low_44 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 30 - 272
Target Start/End: Complemental strand, 52296996 - 52296754
Alignment:
| Q |
30 |
agtatgaaacacaaatcattgttaatttcgttctcccctacacattcagcatctaggaacaagttagctatacaccttggatccaacccctgataatagt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52296996 |
agtatgaaacacaaatcattgttaatttcgttctcccctacacattcagcatctaggaacaagttagctatacaccttggatccaacccctgataatagt |
52296897 |
T |
 |
| Q |
130 |
taacaagccaacagttaaaacaaatcacaaacaactgaatttactagcaactttttactctatattaaccttaagctaaatcctaactcatagacacaac |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52296896 |
taacaagccaacagttaaaacaaatcacaaacaactgaatttactagcaactttttactctatattaaccttaagctaaatcctaactgatagacacaac |
52296797 |
T |
 |
| Q |
230 |
acaatatatactatagtagtttcataattcataaataaacaaa |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52296796 |
acaatatatactatagtagtttcataattcataaataaacaaa |
52296754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 60 - 127
Target Start/End: Complemental strand, 6827274 - 6827207
Alignment:
| Q |
60 |
ttctcccctacacattcagcatctaggaacaagttagctatacaccttggatccaacccctgataata |
127 |
Q |
| |
|
||||| ||||||||| | || |||| |||||||| ||| ||||||||||||||| |||||||||||| |
|
|
| T |
6827274 |
ttctctcctacacatactgcgtctaaaaacaagttggctgtacaccttggatccagcccctgataata |
6827207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University