View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0619_low_47 (Length: 260)
Name: NF0619_low_47
Description: NF0619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0619_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 99 - 238
Target Start/End: Original strand, 41668085 - 41668224
Alignment:
| Q |
99 |
cgaaattatttgattccaggatcacagnnnnnnncattttttccatttatgatacacacggctacatgaattgttcaactactacgacttttctgttatg |
198 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41668085 |
cgaaattatttgattccaggatcacagaaaaaaacattttttccatttatgatacacacggctacatgaattgttcaactactacgacttttctgttatg |
41668184 |
T |
 |
| Q |
199 |
agtagtaaccttcaacccaaatcttgcccaacattgtgcc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41668185 |
agtagtaaccttcaacccaaatcttgcccaacattgtgcc |
41668224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University