View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0619_low_49 (Length: 256)
Name: NF0619_low_49
Description: NF0619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0619_low_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 41667843 - 41667595
Alignment:
| Q |
1 |
ataaacttaattaagagatcaatgcaccctatgatgggtgctctagaaatagaacatggacaaagaaaacaattaggaaaaacctattttggcaacttcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41667843 |
ataaacttaattaagagatcaatgcaccctatgatgggtgctctagaaatagaacatggacaaagaaaacaattaggaaaaacctattttggcaacttct |
41667744 |
T |
|
| Q |
101 |
tcgttcaactcacgagacacgaccatgagcttcatcgtacccttacttgcacgttgtataccccactgtagccggccctgtctannnnnnnnnnnnnnat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41667743 |
tcgttcaactcacgagacacgaccatgagcttcatcgtacccttacttgcacgttgtataccccactgtagccggccctgtctatttttttcttttttat |
41667644 |
T |
|
| Q |
201 |
atccaatcaatttgcatgatcccacgataaatccctttaagaataatct |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41667643 |
atccaatcaatttgcatgatcccacgataaatccctttaagaaaaatct |
41667595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1189 times since January 2019
Visitors: 3841