View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0619_low_50 (Length: 254)
Name: NF0619_low_50
Description: NF0619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0619_low_50 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 85 - 254
Target Start/End: Complemental strand, 1881193 - 1881024
Alignment:
| Q |
85 |
gttgaaataccaggtcctagtaatctgaactacgaccataaatgacttaatttatttattctcacgtgacaaaattataagactagtatgtactgtacaa |
184 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1881193 |
gttgaaataccaggccctagtaatctgaactactaccataaatgacttaatttatttattctcacgtgataaaattataagactagtatgtactgtacaa |
1881094 |
T |
|
| Q |
185 |
ctttttaatcgccgtatttcgacgaaatttactgcaagaataatagaatgaattgagtgacttaggaaat |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1881093 |
ctttttaatcgccgtatttcgacgaaatttactgcaagaataatagtatgaattgagtgacttaggaaat |
1881024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 200 times since January 2019
Visitors: 3833