View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0619_low_51 (Length: 251)
Name: NF0619_low_51
Description: NF0619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0619_low_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 80 - 219
Target Start/End: Original strand, 41668085 - 41668224
Alignment:
Q |
80 |
cgaaattatttgattccaggatcacagnnnnnnncattttttccatttatgatacacacggctacatgaattgttcaactactacgacttttctgttatg |
179 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41668085 |
cgaaattatttgattccaggatcacagaaaaaaacattttttccatttatgatacacacggctacatgaattgttcaactactacgacttttctgttatg |
41668184 |
T |
 |
Q |
180 |
agtagtaaccttcaacccaaatcttgcccaacattgtgcc |
219 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41668185 |
agtagtaaccttcaacccaaatcttgcccaacattgtgcc |
41668224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 550 times since January 2019
Visitors: 3835