View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0619_low_55 (Length: 250)

Name: NF0619_low_55
Description: NF0619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0619_low_55
NF0619_low_55
[»] chr2 (1 HSPs)
chr2 (1-241)||(11827516-11827765)


Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 11827516 - 11827765
Alignment:
1 aaagcaaaaccagtgtgataggcatttttattttgaaagaagtgtgatattttagacagtttgtatgtgggacaaagcaggaccggcccaaggcataggt 100  Q
    |||| |||| || ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||    
11827516 aaaggaaaatcaatgtgatatgcatttttattttgaaagaagtgtgatattttagacagtttgtatgtgggacaaagcagggccggaccaaggcataggt 11827615  T
101 cgagggtgcggtgactttggatccattcccgtagggacccatacnnnnnnnnnccgggg---------gtgtatatatcaacactttgtttaaagagagt 191  Q
    || |||||||||||||||||||||||||||| |||||||||||             |||         |||| |||||||||||||||||||||||||||    
11827616 cgggggtgcggtgactttggatccattcccgcagggacccatatttttttttttttgggaggtggcgggtgtttatatcaacactttgtttaaagagagt 11827715  T
192 ctatatagaaaaaattgcaaagaaggcccaaccctttatcgaactgcatc 241  Q
    |||||||||||||||||||| |||||||||||||||||||| ||| ||||    
11827716 ctatatagaaaaaattgcaatgaaggcccaaccctttatcggacttcatc 11827765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University