View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0619_low_66 (Length: 229)
Name: NF0619_low_66
Description: NF0619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0619_low_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 23 - 160
Target Start/End: Complemental strand, 41668222 - 41668085
Alignment:
Q |
23 |
cacaatgttgggcaagatttgggttgaaggttactactcataacagaaaagtcgtagtagttgaacaattcatgtagccgtgtgtatcataaatggaaaa |
122 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41668222 |
cacaatgttgggcaagatttgggttgaaggttactactcataacagaaaagtcgtagtagttgaacaattcatgtagccgtgtgtatcataaatggaaaa |
41668123 |
T |
 |
Q |
123 |
aatgtttttttctgtgatcctggaatcaaataatttcg |
160 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
41668122 |
aatgtttttttctgtgatcctggaatcaaataatttcg |
41668085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University