View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0619_low_68 (Length: 227)
Name: NF0619_low_68
Description: NF0619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0619_low_68 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 11826976 - 11827196
Alignment:
| Q |
7 |
aaaaagaagagaataatagtggtgctcaagtgagggagacatgtttggttatagtagtggcttttgcaggtgaaaatggaagtggaggaatggatcttct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11826976 |
aaaaagaagagaataatagtggtgctcaagtgagggagacatgtttggttatagtagtggcttttgcaggtgaaaaaggaagtggaggaatggatcttct |
11827075 |
T |
|
| Q |
107 |
cagcatataccttgagaaaccttggctgcttttttgccatttatttactttatctaaaaaattaggaaaatgtttcttatacacccacccaaatgtgtat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
11827076 |
cagcatataccttgagaaaccttggctgcttttttgccatttatttactttatctaaaaaattaggaaaatgtttcttacacacccatccaaatgtgtat |
11827175 |
T |
|
| Q |
207 |
acaccatgagaggaaagttga |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
11827176 |
acaccatgagaggaaagttga |
11827196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 7 - 167
Target Start/End: Original strand, 11840802 - 11840961
Alignment:
| Q |
7 |
aaaaagaagagaataatagtggtgctcaagtgagggagacatgtttggttatagtagtggcttttgcaggtgaaaatggaagtggaggaatggatcttct |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| | |||||||||||| ||||||||| | ||||||| ||| ||||||||| |
|
|
| T |
11840802 |
aaaaagaagagaataatagtggtgctcaagtgagggaaacatgtttggttttcatagtggcttttgtaggtgaaaaagaaagtgga-gaaaggatcttct |
11840900 |
T |
|
| Q |
107 |
cagcatataccttgagaaaccttggctgcttttttgccatttatttactttatctaaaaaa |
167 |
Q |
| |
|
||||||||||||||| ||| |||| ||||||| ||||||| ||||||||| |||||||| |
|
|
| T |
11840901 |
cagcatataccttgacaaaatttggttgcttttctgccattgatttacttttcctaaaaaa |
11840961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 195 times since January 2019
Visitors: 3831