View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0620_high_4 (Length: 245)
Name: NF0620_high_4
Description: NF0620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0620_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 217
Target Start/End: Complemental strand, 13152652 - 13152445
Alignment:
| Q |
15 |
acattatactgagttcaaactat-----tcaaggacagatgaataattttattataaagttcatcattttgtgaacatggttttgctcattgccatgttc |
109 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13152652 |
acattatactgagttcaaactatactattcaaggacagatgaataattttattataaagttcatcattttgtgaacatggttttgctcattgccatgttc |
13152553 |
T |
 |
| Q |
110 |
caacactgaactgtatatagtgatttcacaaaatccagacccatgcacgcagattatgtgtataaattgtcgtctagcttgttgtatgtagcagtacttt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13152552 |
caacactgaactgtatatagtgatttcacaaaatccagacccatgcacgcagattatgtgtataaattgtcgtctagcttgttgtatgtagcagtacttt |
13152453 |
T |
 |
| Q |
210 |
ttctatca |
217 |
Q |
| |
|
|||||||| |
|
|
| T |
13152452 |
ttctatca |
13152445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University