View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0620_low_5 (Length: 336)
Name: NF0620_low_5
Description: NF0620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0620_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 58 - 315
Target Start/End: Original strand, 43256521 - 43256777
Alignment:
Q |
58 |
ctgacaaagccctagctgttgcaataaaccccagatgagcagcttgtcccccatgagacatgagggccacaggtgttgaaggtttacacaaggtggggaa |
157 |
Q |
|
|
||||| |||||| ||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43256521 |
ctgacgaagcccatgcttttgcaataaaccc-agatgagcagcttgtcccccatgagacatgagggccacaggtgttgaaggtttacacaaggtggggaa |
43256619 |
T |
 |
Q |
158 |
atggggcagcggaaaaaattaagaggcaatatgtgttaataggaaccaggctctgtcgcagcccctttgaaatcctccagttccctctaagattaagtct |
257 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43256620 |
atggggcagcggaaaaaattaagaggcaatatgtgttaataggaaccaggctctgtcgcagcccctttgaaatcctccagttccctctaagattaagtct |
43256719 |
T |
 |
Q |
258 |
tttctctgacgctccctcttttatttgaagttccctctacacatgcatgtcctgatga |
315 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43256720 |
tttctctgacgctccctcttttatttgaagttccctctacacatgcatgtcctgatga |
43256777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University