View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0620_low_8 (Length: 202)

Name: NF0620_low_8
Description: NF0620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0620_low_8
NF0620_low_8
[»] chr3 (1 HSPs)
chr3 (41-181)||(41649672-41649812)


Alignment Details
Target: chr3 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 41 - 181
Target Start/End: Original strand, 41649672 - 41649812
Alignment:
41 cagagagtaccggtaagatttgacgtaattaaactatcatctctcaccatacaacattactttgatgctgattgaaatttttgttattgaaactatgtgc 140  Q
    ||||||||||  |||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||    
41649672 cagagagtactagtaagatttgacgtaattaaactatcatctctcaccatacaaaattaccttgatgctgattgaaatttttgttattgaaactatgtgc 41649771  T
141 aacatttgagaaaatggaataacaagaaaagacggatggat 181  Q
    |||||||||||||||||||||||||||||||||||||||||    
41649772 aacatttgagaaaatggaataacaagaaaagacggatggat 41649812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2008 times since January 2019
Visitors: 3810