View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0620_low_8 (Length: 202)
Name: NF0620_low_8
Description: NF0620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0620_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 41 - 181
Target Start/End: Original strand, 41649672 - 41649812
Alignment:
| Q |
41 |
cagagagtaccggtaagatttgacgtaattaaactatcatctctcaccatacaacattactttgatgctgattgaaatttttgttattgaaactatgtgc |
140 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41649672 |
cagagagtactagtaagatttgacgtaattaaactatcatctctcaccatacaaaattaccttgatgctgattgaaatttttgttattgaaactatgtgc |
41649771 |
T |
 |
| Q |
141 |
aacatttgagaaaatggaataacaagaaaagacggatggat |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41649772 |
aacatttgagaaaatggaataacaagaaaagacggatggat |
41649812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University