View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0621_high_12 (Length: 252)
Name: NF0621_high_12
Description: NF0621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0621_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 4444822 - 4444982
Alignment:
| Q |
1 |
aaaagccacgtttgcggctgctttgttgacaaaagagtaatttgttagaggttgcgaagttacacagttagagtcaccggacacacagaggcctcttctg |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4444822 |
aaaagccacgtttgcggctgcgttgttgacaaaagagtaatttgttagaggttgcaaagttacacagttagagtcaccggacacac-gaggcctcttctg |
4444920 |
T |
|
| Q |
101 |
tttattgtcgttaatgatcattgctaattccttgtttgtcaacatcatccctctaagaaactcac |
165 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4444921 |
tttattgtcgttaatgatcattgc---ttccttgtttgtcaacatcatccctctaagaaactcac |
4444982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 193 - 241
Target Start/End: Original strand, 4445016 - 4445064
Alignment:
| Q |
193 |
aaccatagtcttgtttccttccattgtttgatttttctgtcttgttcat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4445016 |
aaccatagtcttgtttccttccattgtttgatttttctgtgttgttcat |
4445064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 17 - 65
Target Start/End: Complemental strand, 37558528 - 37558480
Alignment:
| Q |
17 |
gctgctttgttgacaaaagagtaatttgttagaggttgcgaagttacac |
65 |
Q |
| |
|
||||| |||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
37558528 |
gctgcattgttgacaaaagaataatttggtagaggttgcgaagttacac |
37558480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 746 times since January 2019
Visitors: 3837