View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0621_high_3 (Length: 695)
Name: NF0621_high_3
Description: NF0621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0621_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 8e-60; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 8e-60
Query Start/End: Original strand, 9 - 134
Target Start/End: Original strand, 21268954 - 21269079
Alignment:
Q |
9 |
agcagagagtgaaaccggaaaagtaaccgtcaccggaaatgtggaccccacaaaactgagagacaatcttgctgagaagattaagaagaaagttgaactc |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21268954 |
agcagagagtgaaaccggaaaagtaaccgtcaccggaaatgtggaccccacaaaactgagagacaatcttgctgagaagattaagaagaaagttgaactc |
21269053 |
T |
 |
Q |
109 |
atgtcaccacttcccaagaaggataa |
134 |
Q |
|
|
|| |||||| |||||||||||||||| |
|
|
T |
21269054 |
atttcaccaattcccaagaaggataa |
21269079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 117; E-Value: 3e-59
Query Start/End: Original strand, 292 - 408
Target Start/End: Original strand, 21269239 - 21269355
Alignment:
Q |
292 |
atgtaacagtcaattaccacttctgttttgaaattggtactacactgtcaaggatgtattgataagattgggaaaattgttatgaaaactaaaggtgggt |
391 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21269239 |
atgtaacagtcaattaccacttctgttttgaaattggtactacactgtcaaggatgtattgataagattgggaaaattgttatgaaaactaaaggtgggt |
21269338 |
T |
 |
Q |
392 |
ttttatttttcaatatt |
408 |
Q |
|
|
||||||||||||||||| |
|
|
T |
21269339 |
ttttatttttcaatatt |
21269355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 476 - 529
Target Start/End: Original strand, 21269426 - 21269479
Alignment:
Q |
476 |
ggagtgcttgaaatgaaagttgataaagagaaagataatgtgactgtgaagggt |
529 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21269426 |
ggagtgcttgaaatgaaagttgataaagagaaagataatgtgactgtgaagggt |
21269479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University