View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0621_low_13 (Length: 328)
Name: NF0621_low_13
Description: NF0621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0621_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 9 - 299
Target Start/End: Complemental strand, 31304163 - 31303867
Alignment:
Q |
9 |
caacaatatggccatagcgtaggatttcacaacgtagaatgtcgtccaacggatcaagcaaaccgtcccaatttctcatcccctgatactccttccacct |
108 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
31304163 |
caacaaaatggccatagcgtaggatttcacaacgtagaatgtcgtccaacggatcaagcaaaccgtcccaatttctcatcccttgatactccttccacct |
31304064 |
T |
 |
Q |
109 |
ttctccaactgttttagtttttgaacccaaaggtggtgatgatgatgatggtgatgagtgtaaagatgggaaattgttatggttttcgagatttatcgtg |
208 |
Q |
|
|
|| ||||| |||||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31304063 |
ttttccaagtgttttagtttttggatccataggtggtgatgatgatgatggtgatgagtgtaaagatgggaaattgttatggttttcgagatttatcgtg |
31303964 |
T |
 |
Q |
209 |
ttttctaagtgtaacgtggatttttgagtgttatcaattagttta------tgagtatggataatacagtgcagtttgagggtgtaggtattggttg |
299 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
31303963 |
ttttctaagtgtaacgtggatttttgagtgttatcaattagtttatctgtttgagtatggataacacagtgcagtttgagggtgtaggtattggttg |
31303867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University