View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0621_low_20 (Length: 252)
Name: NF0621_low_20
Description: NF0621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0621_low_20 |
 |  |
|
[»] scaffold0009 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0009 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 100650 - 100412
Alignment:
Q |
1 |
ctttcatttcatttatagaagcctcattcattagaccataatcacgaacattagacgagcacacatgacaacattcgtttagaccataatcatgaatatt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
T |
100650 |
ctttcatttcatttatagaagcctcattcatttgaccataatcacgaacattagacgagcacacatgacaacattcgtttagaccataatcacgaacatt |
100551 |
T |
 |
Q |
101 |
cgatatacaattccaattgaactagcaaagtatattttttaaccttattttttgttcaacgcacaatgtcttgccgcatcctgtgaatatataatgtaag |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| ||| ||||||||| ||||||||| |
|
|
T |
100550 |
cgatatacaattccaattgaactagcaaagtatattttttaacccttttttttgttcaacgcacaatgtcttgccgaatcttgtgaatatttaatgtaag |
100451 |
T |
 |
Q |
201 |
agtaacttggtgagcaaggaaaggtgggtgggcctattc |
239 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
100450 |
agtaacttggtgagcaaggaaaggtgggtgggcctattc |
100412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 11 - 52
Target Start/End: Original strand, 10266985 - 10267026
Alignment:
Q |
11 |
atttatagaagcctcattcattagaccataatcacgaacatt |
52 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
10266985 |
atttatagaagcctcattcattagaccacaatcacgaacatt |
10267026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 467 times since January 2019
Visitors: 3834