View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0621_low_26 (Length: 204)
Name: NF0621_low_26
Description: NF0621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0621_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 10298795 - 10298678
Alignment:
Q |
1 |
catacagttcagtgaagacagagagccgtagcatgtcttggaagcttatttatggtttttagctgtattctttgcaaagaag--agagtgaaaaaactta |
98 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
10298795 |
catacagttcagtgaagacagaa--ccgtagcatgtcttggaagcttatttatggtttttagctgtattctttgcaaagaagagagagtgaaaaaacttg |
10298698 |
T |
 |
Q |
99 |
aataaagttttatgtctctg |
118 |
Q |
|
|
|||||||||||||| ||||| |
|
|
T |
10298697 |
aataaagttttatgcctctg |
10298678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University