View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0621_low_9 (Length: 402)
Name: NF0621_low_9
Description: NF0621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0621_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 1 - 308
Target Start/End: Complemental strand, 21269055 - 21268748
Alignment:
| Q |
1 |
atgagttcaactttcttcttaatcttctcagcaagattgtctctcagttttgtggggtccacatttccggtgacggttacttttccggtttcactctctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21269055 |
atgagttcaactttcttcttaatcttctcagcaagattgtctctcagttttgtggggtccacatttccggtgacggttacttttccggtttcactctctg |
21268956 |
T |
|
| Q |
101 |
ctttcaccgtatcaacaccttaaaaacagaaacatggttgttcaattttaacgattgaaaaatgaattgaagaacaatgatgaaaacccagatcggaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21268955 |
ctttcaccgtatcaacaccttaaaaacagaaacatggttgttcaattttaacgattgaaaaatgaattgaagaacaatgatgaaaacccagatcggaaaa |
21268856 |
T |
|
| Q |
201 |
aatgtgtagaaacagaggagtgtgagaaaaatgatacctttgatactgttaaggtgtttggttactttgttagcgcaaccttcgcaatgcatatagactt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21268855 |
aatgtgtagaaacagaggagtgtgagaaaaatgatacctttgatgccgttaaggtgtttggtgactttgttagcgcaaccttcgcaatgcatatagactt |
21268756 |
T |
|
| Q |
301 |
tcaaaacc |
308 |
Q |
| |
|
|||||||| |
|
|
| T |
21268755 |
tcaaaacc |
21268748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2925 times since January 2019
Visitors: 3831