View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_high_21 (Length: 554)
Name: NF0622_high_21
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0622_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 92; Significance: 2e-44; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 188 - 287
Target Start/End: Complemental strand, 3870202 - 3870103
Alignment:
Q |
188 |
tttagggagtaaatatatcgagaaatttattttaggcaaaattgttttttgaagagaaactctacgaaactaagagtgcaagtcgtccctttagcacaaa |
287 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
T |
3870202 |
tttagggagtaaatatatcgagaaatttattttaggcaaaattgttttttgaagagaaactctatgaaactaagagtgcaagtcatccctttagcacaaa |
3870103 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 316 - 384
Target Start/End: Complemental strand, 3870100 - 3870032
Alignment:
Q |
316 |
tgaactattaagaatgaaaaataaatctggtttaactcatctaatgcatcatttgctcaagtttaatcg |
384 |
Q |
|
|
||||||||||| ||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3870100 |
tgaactattaaaaatgaaacataactctggtttaactcatctaatgcatcatttgctcaagtttaatcg |
3870032 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University