View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_high_26 (Length: 523)
Name: NF0622_high_26
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0622_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 411; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 411; E-Value: 0
Query Start/End: Original strand, 99 - 513
Target Start/End: Complemental strand, 40085116 - 40084702
Alignment:
| Q |
99 |
tgggttcattaccggggttaaccaatctcattctctgtcacaaccgtttaaccggttcacttccccggtttgattctcaaagcttaagccggttggacct |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40085116 |
tgggttcattaccggggttaaccaatctcattctctgtcacaaccgtttaaccggttcacttccccggtttgattctcaaagcttaagccggttggacct |
40085017 |
T |
 |
| Q |
199 |
aaagcacaactctctcaccggttcgattggtccaaattttctccctgcgtcacttcagtatctctcattgtcatggaatcaattcacgggctcaatggac |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40085016 |
aaagcacaactctctcaccggttcgattggtccaaattttctccctgcgtcacttcagtatctctcattgtcatggaatcaattcaccggctcaatggac |
40084917 |
T |
 |
| Q |
299 |
cgggttctaacccggcttaatcagttaaactatttagacctgagtctgaaccaattcactggacctcttccgggtaaggtattctcattcccactgacaa |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40084916 |
cgggttctaacccggcttaatcagttaaactatttagacctgagtctgaaccaattcactggacctcttccgggtaaggtattctcattcccactgacaa |
40084817 |
T |
 |
| Q |
399 |
atctccaattagaaagaaaccagtttaccggttcagttgaaccggtggatcaagttgcaattccaaccgttgatcttagctttaaccggttatctggtca |
498 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40084816 |
atctccaattagaaagaaaccagtttaccggttcagttgaaccggtggatcaagttgcaattccaaccgttgatcttagctttaaccggttatctggtca |
40084717 |
T |
 |
| Q |
499 |
aatatcacctatgct |
513 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
40084716 |
aatatcacctatgct |
40084702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University