View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_high_34 (Length: 440)
Name: NF0622_high_34
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0622_high_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 109 - 326
Target Start/End: Original strand, 31643186 - 31643403
Alignment:
Q |
109 |
gtgttagccctccggttcggttagaatataagttaagcatgtcagaggattgtaccatccagaaatcgaactcattattctcttctttattatctggttc |
208 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
T |
31643186 |
gtgttagccctccggttcggttagaatataagttaagcatgtcaaaggattgtaccatccgggaatcgaactcattattctcttctttattatctggttc |
31643285 |
T |
 |
Q |
209 |
ttccttaatttcaaccggatgtgaattttcttgttgaagcgccttctcataaggaccgagttgttcgcccatactactaccaatgtcggtactagccaac |
308 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31643286 |
ttccttaatttcaaccagatgtgaattttcttgttgaagcgccttctcataatgaccgagttgttcgcccatactactaccaatgtcggtactagccaac |
31643385 |
T |
 |
Q |
309 |
tgcgatgaaggtgaatgg |
326 |
Q |
|
|
|| ||||||||||||||| |
|
|
T |
31643386 |
tgtgatgaaggtgaatgg |
31643403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 13 - 61
Target Start/End: Original strand, 31643087 - 31643135
Alignment:
Q |
13 |
aatatgtctggtaagctttcaccatctctaaaagagggacagaggcatg |
61 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
31643087 |
aatatgtctggtaagctttcaccatctctaaaagaggggcagaggcatg |
31643135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University