View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_high_47 (Length: 385)
Name: NF0622_high_47
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0622_high_47 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 1 - 353
Target Start/End: Original strand, 15188102 - 15188456
Alignment:
| Q |
1 |
agctgttcttgaattctgtctctgattgctgttccctggtttatcagtaaaccaacaaattcagtcaatcagaagttatacaaaatgcagaatctaacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15188102 |
agctgttcttgaattctgtctctgattgctgttccctggtatatcagtaaaccaaccaattcagtcaatcagaagttatacaaaatgcagaatctaacaa |
15188201 |
T |
|
| Q |
101 |
gaaattaacaggattccatgcaaaaattagtcatctaatatagtaaaacttaattttagggaggaaagag--atccaaccattttgtggcatccttcttc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15188202 |
gaaattaacaggattccatgcaaaaattagtcatctaatatagtaaaacttagttttagggaggaaagagagatccaaccattttgtggcatccttcttc |
15188301 |
T |
|
| Q |
199 |
aaacatctcgagaaatccagcaactaatcgatctgcattttcaacccattcggtacggttcatcccagcaattcttctcactgttcctatctgcacatag |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15188302 |
aaacatctcgagaaatccagcaactaatcgatctgcattttcaacccattcggtacggttcatcccggcaattcttctcactgttcctatctgcacatag |
15188401 |
T |
|
| Q |
299 |
tttggcttgtcatatgatagtgtctcaataatgcaaaggatcatttagaataatc |
353 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
15188402 |
tttggcttgtcatatgatagtgtcttaataatgcaatggatcatttagaataatc |
15188456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 177 - 290
Target Start/End: Complemental strand, 24190455 - 24190342
Alignment:
| Q |
177 |
ccattttgtggcatccttcttcaaacatctcgagaaatccagcaactaatcgatctgcattttcaacccattcggtacggttcatcccagcaattcttct |
276 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
24190455 |
ccattttgtggtatccttcttcaaacatctcgagaaatccagcaactaatcgatctgcattttcaacccattcagtacggttcatccccgcaattcttct |
24190356 |
T |
|
| Q |
277 |
cactgttcctatct |
290 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
24190355 |
cactgttcctatct |
24190342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 24190489 - 24190454
Alignment:
| Q |
1 |
agctgttcttgaattctgtctctgattgctgttccc |
36 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24190489 |
agctgttcttgaattctgtctctgattgccgttccc |
24190454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 176 - 246
Target Start/End: Original strand, 36913508 - 36913578
Alignment:
| Q |
176 |
accattttgtggcatccttcttcaaacatctcgagaaatccagcaactaatcgatctgcattttcaaccca |
246 |
Q |
| |
|
||||| || ||||| |||||||||||||| || |||||||||||||| | ||||| |||||||| ||||| |
|
|
| T |
36913508 |
accatcttatggcaaccttcttcaaacatttctagaaatccagcaaccatacgatcagcattttccaccca |
36913578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 696 times since January 2019
Visitors: 3837