View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_high_51 (Length: 371)
Name: NF0622_high_51
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0622_high_51 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 253; Significance: 1e-140; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 4 - 321
Target Start/End: Complemental strand, 33927714 - 33927387
Alignment:
Q |
4 |
atctcgaataatatttgggaggcagaagttattgtggaaccttgcaggcttggcgagaaggtgtgcctccaatgtccttagggagtgaagatggagatgt |
103 |
Q |
|
|
|||||| ||| ||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33927714 |
atctcgtatactatttgggaggcagatattattgtggaaccttgtaggcttggcgagaaggtgtgcctccaatgtccttagggagtgaagatggagatgc |
33927615 |
T |
 |
Q |
104 |
ttcatatgtattcgtttgtttttgaggatatagggtttaagtttccttttactaactttgagtgtgatttccttaaggct----------ctccatcaca |
193 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
T |
33927614 |
ttcatatgtattcgtttgtttttgaggatatagggtttaagtttccttttactaactttgagtgtgatttccttaaggctcttaacgtcgcttcatcaca |
33927515 |
T |
 |
Q |
194 |
acttcatccaaactgttgtgcgttcatgtgcagtttcgagatcttgtgcgaaagcttggggtttcgccaatgtttttaaaattggaccagaggttaaacc |
293 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
33927514 |
acttcatccaaactgttgtgcgttcatgtgcggtttcgagatctcgtgcgaaagcttggggtttcgccaatgtttataaaattggaccagaggttaaacc |
33927415 |
T |
 |
Q |
294 |
gttgtgatgttcgggtcaaggttcaacc |
321 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
33927414 |
gttgtgatgttcgggtcaaggttcaacc |
33927387 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 283 - 319
Target Start/End: Original strand, 9083428 - 9083464
Alignment:
Q |
283 |
gaggttaaaccgttgtgatgttcgggtcaaggttcaa |
319 |
Q |
|
|
||||||||| ||||||||| ||||||||||||||||| |
|
|
T |
9083428 |
gaggttaaatcgttgtgatattcgggtcaaggttcaa |
9083464 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 283 - 319
Target Start/End: Original strand, 6414632 - 6414668
Alignment:
Q |
283 |
gaggttaaaccgttgtgatgttcgggtcaaggttcaa |
319 |
Q |
|
|
||||||||| ||||||||| ||||||||||||||||| |
|
|
T |
6414632 |
gaggttaaatcgttgtgatattcgggtcaaggttcaa |
6414668 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University