View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0622_high_57 (Length: 329)

Name: NF0622_high_57
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0622_high_57
NF0622_high_57
[»] chr8 (2 HSPs)
chr8 (97-197)||(36662941-36663041)
chr8 (263-293)||(36663107-36663137)


Alignment Details
Target: chr8 (Bit Score: 101; Significance: 5e-50; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 97 - 197
Target Start/End: Original strand, 36662941 - 36663041
Alignment:
97 ttgaacactcaggttgttgttcgagttgcacgtgtgtctgcacaaacgtggcaatggttgtcttgcattcatgatccaataaacagtgatcagcttttgg 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36662941 ttgaacactcaggttgttgttcgagttgcacgtgtgtctgcacaaacgtggcaatggttgtcttgcattcatgatccaataaacagtgatcagcttttgg 36663040  T
197 a 197  Q
    |    
36663041 a 36663041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 263 - 293
Target Start/End: Original strand, 36663107 - 36663137
Alignment:
263 gtcttcctcaaccttattccttttactcttc 293  Q
    |||||||||||||||||||||||||||||||    
36663107 gtcttcctcaaccttattccttttactcttc 36663137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University