View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_high_59 (Length: 319)
Name: NF0622_high_59
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0622_high_59 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 12 - 291
Target Start/End: Original strand, 48016333 - 48016612
Alignment:
| Q |
12 |
aaaggaagcacgtgtgtctttgcctcgaaaacttaggaacacttcattaatccttaattctttcgaggcattcttcattgatgtgtgatcattccaaaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48016333 |
aaaggaagcacgtgtgtctttgcctcgaaaacttaggaacacttcattaatccttaattctttcgaggcattcttcattgatgtgtgatcattccaaaat |
48016432 |
T |
|
| Q |
112 |
gattgtgcagattgggggaagttaatgaaggaagacatggatggatgagataagagaagcaatgttacttgctccgatgtgcagtttttgtttgtggcgg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48016433 |
gattgtgcagattgggggaagttaatgaaggaagacatggatggatgagataagagaagcaatgttgcttgctccgatgtgcagtttttgtttgtggcgg |
48016532 |
T |
|
| Q |
212 |
tcaacgtaacatgttccttcaatgtcacttcatggcttgtttaaatttgtaatcattgtttccatgactacaaaatttat |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48016533 |
tcaacgtaacatgttccttcaatgtcacttcatggcttgtttaaatttgtaatcattgtttccatgactacaaaatttat |
48016612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 208 - 291
Target Start/End: Original strand, 5166586 - 5166670
Alignment:
| Q |
208 |
gcggtcaacgtaacat--gttccttcaatgtcacttcatggcttgtttaaatttgtaatcattgtttccatgactacaaaatttat |
291 |
Q |
| |
|
|||||||||||||||| ||| |||| |||||||||||||||||||| |||| ||||||| ||||||| || ||||||||||| |
|
|
| T |
5166586 |
gcggtcaacgtaacatatgtttcttccttgtcacttcatggcttgttttgattt-aaatcattctttccataacgacaaaatttat |
5166670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2448 times since January 2019
Visitors: 3819