View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0622_high_69 (Length: 289)

Name: NF0622_high_69
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0622_high_69
NF0622_high_69
[»] chr4 (1 HSPs)
chr4 (13-183)||(47179921-47180091)


Alignment Details
Target: chr4 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 13 - 183
Target Start/End: Complemental strand, 47180091 - 47179921
Alignment:
13 atgaggttttcagggtgaatgactgaagtcatcacagtttcttttcatcttttgctggctgaattgactaccctatgttaacttttgaaattattgaaag 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47180091 atgaggttttcagggtgaatgactgaagtcatcacagtttcttttcatcttttgctggctgaattgactaccctatgttaacttttgaaattattgaaag 47179992  T
113 tacttgcaccctctttcttttgtcatcatacaaggagtggatgtgtgtgagtttttggtcattttccctat 183  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47179991 tacttgcaccctctttcttttgtcatcatacaaggagtggatgtgtgtgagtttttggtcattttccctat 47179921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University