View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_high_70 (Length: 285)
Name: NF0622_high_70
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0622_high_70 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 15188102 - 15188383
Alignment:
| Q |
1 |
agctgttcttgaattctgtctctgattgctgttccctggtttatcagtaaaccaacaaattcagtcaatcagaagttatacaaaatgcagaatctaacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15188102 |
agctgttcttgaattctgtctctgattgctgttccctggtatatcagtaaaccaaccaattcagtcaatcagaagttatacaaaatgcagaatctaacaa |
15188201 |
T |
|
| Q |
101 |
gaaattaacaggattccatgcaaaaattagtcatctaatatagtaaaacttaattttagggaggaa--agagatccaaccattttgtggcatccttcttc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15188202 |
gaaattaacaggattccatgcaaaaattagtcatctaatatagtaaaacttagttttagggaggaaagagagatccaaccattttgtggcatccttcttc |
15188301 |
T |
|
| Q |
199 |
aaacatctcgagaaatccagcaactaatcgatctgcattttcaacccattcggtacggttcatcccagcaattcatctcact |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
15188302 |
aaacatctcgagaaatccagcaactaatcgatctgcattttcaacccattcggtacggttcatcccggcaattcttctcact |
15188383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 177 - 280
Target Start/End: Complemental strand, 24190455 - 24190352
Alignment:
| Q |
177 |
ccattttgtggcatccttcttcaaacatctcgagaaatccagcaactaatcgatctgcattttcaacccattcggtacggttcatcccagcaattcatct |
276 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| ||| |
|
|
| T |
24190455 |
ccattttgtggtatccttcttcaaacatctcgagaaatccagcaactaatcgatctgcattttcaacccattcagtacggttcatccccgcaattcttct |
24190356 |
T |
|
| Q |
277 |
cact |
280 |
Q |
| |
|
|||| |
|
|
| T |
24190355 |
cact |
24190352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 24190489 - 24190454
Alignment:
| Q |
1 |
agctgttcttgaattctgtctctgattgctgttccc |
36 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24190489 |
agctgttcttgaattctgtctctgattgccgttccc |
24190454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 246
Target Start/End: Original strand, 36913508 - 36913578
Alignment:
| Q |
176 |
accattttgtggcatccttcttcaaacatctcgagaaatccagcaactaatcgatctgcattttcaaccca |
246 |
Q |
| |
|
||||| || ||||| |||||||||||||| || |||||||||||||| | ||||| |||||||| ||||| |
|
|
| T |
36913508 |
accatcttatggcaaccttcttcaaacatttctagaaatccagcaaccatacgatcagcattttccaccca |
36913578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 567 times since January 2019
Visitors: 3835