View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_high_82 (Length: 251)
Name: NF0622_high_82
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0622_high_82 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 47460342 - 47460100
Alignment:
| Q |
1 |
acgcatggtaatgaacgtggtggtgccaagaaggaagaggatgaagggttttggtgagaagtgatgacagaggccaataaggtttcttgaaactgtaatg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47460342 |
acgcatggtaatgaatgtggtggtgccaagaaggaagaggatgaagggttttggtgagaagtgatgacagaggccaataaggtttcttgaaactgtaatg |
47460243 |
T |
 |
| Q |
101 |
cttcagcgtacttgtcatcggagacagggacgttagggtcaatttcatcgtcggagacaacagagaagtaaaagtcgtcaacggtgtcaggaccaaggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47460242 |
cttcagcgtacttgtcatcggagacaggaacgttagggtcaatttcatcgtcggagacaacagagaagtaaaagtcgtctacggtgtcaggaccaaggaa |
47460143 |
T |
 |
| Q |
201 |
tgaggatgattgttgttgtgccattgttgtttgtgcctatgct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47460142 |
tgaggatgattgttgttgtgccattgttgtttgtgtctatgct |
47460100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 47 - 226
Target Start/End: Complemental strand, 47466900 - 47466724
Alignment:
| Q |
47 |
ggttttggtgagaagtgatgacagaggccaataaggtttcttgaaactgtaatgcttcagcgtacttgtcatcggagacagggacgttagggtcaatttc |
146 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| || ||||||| |||| |
|
|
| T |
47466900 |
ggttttggtgagaagtgatggcagaggccattaaggtttcttggaactgtaatgcttcagcgtacttgtcatcggagacaaaaac---agggtcagtttc |
47466804 |
T |
 |
| Q |
147 |
atcgtcggagacaacagagaagtaaaagtcgtcaacggtgtcaggaccaaggaatgaggatgattgttgttgtgccattg |
226 |
Q |
| |
|
| || |||||| ||||||||||| |||||| || |||||| | |||| ||||||||| ||| |||||| ||||||| |
|
|
| T |
47466803 |
ttgatcaaagacaatagagaagtaaaggtcgtctacagtgtcaaggccaatgaatgaggaggatgcttgttgcgccattg |
47466724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University