View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0622_high_85 (Length: 251)

Name: NF0622_high_85
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0622_high_85
NF0622_high_85
[»] chr1 (2 HSPs)
chr1 (101-244)||(37058256-37058399)
chr1 (1-74)||(37058419-37058492)


Alignment Details
Target: chr1 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 101 - 244
Target Start/End: Complemental strand, 37058399 - 37058256
Alignment:
101 aaaggttaattatttccaattgatcaaggggaatgtagaaaaaaccatgaagcatattaaattttttgggtataaaagtatttccgacagacaatgtata 200  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
37058399 aaaggttaattatttccaattcatcaaggggaatgtagaaaaaaccatgaagcatattaaaatttttgggtataaaagtatttccgacagacaatgtata 37058300  T
201 ttttgcataggattctcactattttttctcttcacccctttgct 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
37058299 ttttgcataggattctcactattttttctcttcacccctttgct 37058256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 37058492 - 37058419
Alignment:
1 aaagataaggtgagacttaagttatccttcgatgtagtttaccccaatgataaataaaaatgaagaaaaagaga 74  Q
    ||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||    
37058492 aaagataaggtgagacttacgttacccttcgatgtagtttaccccaatgataaataaaaatgaagaaaaagaga 37058419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 116 times since January 2019
Visitors: 3831