View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_high_87 (Length: 249)
Name: NF0622_high_87
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0622_high_87 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 17 - 238
Target Start/End: Complemental strand, 13032227 - 13032006
Alignment:
| Q |
17 |
aattattttggttttcccatgatttcaataatgacattcttatgcattcttaacacggtgatttcttaacaccgaaagtgattaattagtctcaagcgat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13032227 |
aattattttggttttcccatgatttcaataatgacattcttatgcattcttaacacggtgatttcttaacaccgaaagtaattaattagtctcaagcgat |
13032128 |
T |
 |
| Q |
117 |
ccttaaagaaaaatatgaatattacatgtgttatttatgatgcaagtgttgaaaaatatgttacattttgtcttgggtaattgatgcagtatcataagta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13032127 |
ccttaaagaaaaatatgaatattacatgtgttatttatgatgcaagtgttgaaaaatatgatacattttgtcttgggtaattgatgtagtatcataagta |
13032028 |
T |
 |
| Q |
217 |
agtatttttgtatcgtcttcat |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
13032027 |
agtatttttgtatcgtcttcat |
13032006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University