View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_high_90 (Length: 237)
Name: NF0622_high_90
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0622_high_90 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 64 - 142
Target Start/End: Original strand, 26926949 - 26927027
Alignment:
| Q |
64 |
cgaggttcaactatagaaaaattagataaatatcataaaaactatctgattgggcttagcctatttgcctaaatattaa |
142 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
26926949 |
cgaggttcaaccatcgaaaaattagataaatatcataaaaactatttaattgggcttagcctatttgcctaaatattaa |
26927027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 79 - 140
Target Start/End: Original strand, 36670132 - 36670194
Alignment:
| Q |
79 |
gaaaaattagataaatatcataaaaactatctgattgggc-ttagcctatttgcctaaatatt |
140 |
Q |
| |
|
||||||| ||||||||||||||||||| || | |||| || |||||||||||||||||||||| |
|
|
| T |
36670132 |
gaaaaatcagataaatatcataaaaacaatttaattgtgcattagcctatttgcctaaatatt |
36670194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University