View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0622_high_90 (Length: 237)

Name: NF0622_high_90
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0622_high_90
NF0622_high_90
[»] chr8 (1 HSPs)
chr8 (64-142)||(26926949-26927027)
[»] chr5 (1 HSPs)
chr5 (79-140)||(36670132-36670194)


Alignment Details
Target: chr8 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 64 - 142
Target Start/End: Original strand, 26926949 - 26927027
Alignment:
64 cgaggttcaactatagaaaaattagataaatatcataaaaactatctgattgggcttagcctatttgcctaaatattaa 142  Q
    ||||||||||| || |||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||    
26926949 cgaggttcaaccatcgaaaaattagataaatatcataaaaactatttaattgggcttagcctatttgcctaaatattaa 26927027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 79 - 140
Target Start/End: Original strand, 36670132 - 36670194
Alignment:
79 gaaaaattagataaatatcataaaaactatctgattgggc-ttagcctatttgcctaaatatt 140  Q
    ||||||| ||||||||||||||||||| || | |||| || ||||||||||||||||||||||    
36670132 gaaaaatcagataaatatcataaaaacaatttaattgtgcattagcctatttgcctaaatatt 36670194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University