View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_high_93 (Length: 223)
Name: NF0622_high_93
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0622_high_93 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 45704218 - 45704424
Alignment:
| Q |
1 |
tacaagttttattatttctcatgcgaaaaatttcacattatttcaactctaaagtctcgagttatttattccttcgatacatgtgataagagcatctatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
45704218 |
tacaagttttattatttctcatgcgaaaaatttcacattatttcagctctaaagtctccggttattcattccttggatacatgtgataagagcatctatt |
45704317 |
T |
|
| Q |
101 |
ctccatgacccaacttacttcagttttcgaactagttaccactaatgcactcgcattttcataacccttatactttgactctttgctccctactaaattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45704318 |
ctccatgacccaacttacttcagttttcgaactagttaccactaatgcactcgcattctcataaccattatactttgactctttgctccctactaaattt |
45704417 |
T |
|
| Q |
201 |
tttgtct |
207 |
Q |
| |
|
||||||| |
|
|
| T |
45704418 |
tttgtct |
45704424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 880 times since January 2019
Visitors: 3837