View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_high_98 (Length: 202)
Name: NF0622_high_98
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0622_high_98 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 81 - 181
Target Start/End: Complemental strand, 36663041 - 36662941
Alignment:
| Q |
81 |
tccaaaagctgatcactgtttattggatcatgaatgcaagacaaccattgccacgtttgtgcagacacacgtgcaactcgaacaacaacctgagtgttca |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36663041 |
tccaaaagctgatcactgtttattggatcatgaatgcaagacaaccattgccacgtttgtgcagacacacgtgcaactcgaacaacaacctgagtgttca |
36662942 |
T |
|
| Q |
181 |
a |
181 |
Q |
| |
|
| |
|
|
| T |
36662941 |
a |
36662941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2918 times since January 2019
Visitors: 3831