View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_low_101 (Length: 289)
Name: NF0622_low_101
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0622_low_101 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 13 - 183
Target Start/End: Complemental strand, 47180091 - 47179921
Alignment:
Q |
13 |
atgaggttttcagggtgaatgactgaagtcatcacagtttcttttcatcttttgctggctgaattgactaccctatgttaacttttgaaattattgaaag |
112 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47180091 |
atgaggttttcagggtgaatgactgaagtcatcacagtttcttttcatcttttgctggctgaattgactaccctatgttaacttttgaaattattgaaag |
47179992 |
T |
 |
Q |
113 |
tacttgcaccctctttcttttgtcatcatacaaggagtggatgtgtgtgagtttttggtcattttccctat |
183 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47179991 |
tacttgcaccctctttcttttgtcatcatacaaggagtggatgtgtgtgagtttttggtcattttccctat |
47179921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University