View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_low_106 (Length: 279)
Name: NF0622_low_106
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0622_low_106 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 133 - 195
Target Start/End: Complemental strand, 55322 - 55260
Alignment:
Q |
133 |
caatagttctataacatttgtgtttactactaccacaatttctattaaatataattgatgatg |
195 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
55322 |
caatagttctataacatttgtgtttgctactaccacaatttctattaaatataattgatgatg |
55260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University