View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_low_110 (Length: 274)
Name: NF0622_low_110
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0622_low_110 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 42 - 142
Target Start/End: Original strand, 36662941 - 36663041
Alignment:
| Q |
42 |
ttgaacactcaggttgttgttcgagttgcacgtgtgtctgcacaaacgtggcaatggttgtcttgcattcatgatccaataaacagtgatcagcttttgg |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36662941 |
ttgaacactcaggttgttgttcgagttgcacgtgtgtctgcacaaacgtggcaatggttgtcttgcattcatgatccaataaacagtgatcagcttttgg |
36663040 |
T |
|
| Q |
142 |
a |
142 |
Q |
| |
|
| |
|
|
| T |
36663041 |
a |
36663041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 238
Target Start/End: Original strand, 36663107 - 36663137
Alignment:
| Q |
208 |
gtcttcctcaaccttattccttttactcttc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36663107 |
gtcttcctcaaccttattccttttactcttc |
36663137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11 times since January 2019
Visitors: 3831