View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0622_low_111 (Length: 271)
Name: NF0622_low_111
Description: NF0622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0622_low_111 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 46 - 244
Target Start/End: Original strand, 45108894 - 45109089
Alignment:
Q |
46 |
aagatacaatatagtacagacaaacataaacattaaagcatgcatcttttgcatttagacttgtcacagctaatgttgaagttatccttgtcttgtggaa |
145 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45108894 |
aagataaaatatagtacagacaaacataaacattaaagcat----cttttgcatttagacttgtcacagctaatgttgaagttatccttgtcttgtggaa |
45108989 |
T |
 |
Q |
146 |
gggatctaatcatctaaatgcaaaatagacaaagataaaata-tgactaatnnnnnnncataacaatgaagcaacgtgtgtatccatccaccctttgttt |
244 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45108990 |
gggatctaatcatctaaatgcaaaatagacaaagataaaatacggactaataaaaaaacataacaatgaagcaacgtgtgtatccatccaccctttgttt |
45109089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University